Alls Quiet on the Western Fro essays

All's Quiet on the Western Fro essays Alls Quiet on the Western Front Lewis Milestones Alls Quiet on the Western Front, based on Erich Remarques novel, is an incredibly disturbing and effective anti-war film. The grainy black and white film is still not outdated and carries a breathtaking initial impact. The prologue that introduces the film gives its anti-war intentions immediately and beautifully. This story is neither an accusation nor a confession, and least of all an adventure, for death is not an adventure to those who stand face to face with it. It will try simply to tell of a generation of men who, even though they may have escaped its shells, were destroyed by the war... Alls Quiet on the Western Front includes a series of vignettes and scenes that portray the senselessness and futility of war from the point of view of young German soldiers in the trenches in the Great War who found no glory on the battlefield, meeting only death and disillusionment. The film brilliantly portrays the war with no enemys, just people and relationships. It is the story of friends, Paul Baumer (Lew Ayres) and his friends joining the war through propaganda, and leaving through death. The most unforgettable scene is the final moments of the film, just before the "all quiet on the western front" armistice and with all of his comrades gone, soldiers are bailing water out of a dilapidated trench. The faint sound of a harmonica can be heard. Paul is sitting alone, daydreaming inside the trench on a seemingly peaceful, bright day. He is exhausted by terror and boredom. Through the gunhole of his trench, he sees a beautiful lone butterfly that has landed just beyond his reach next to a discarded tin can outside the parapet. He begins to carefully reach out over the protection of his bunker with his hand to grasp it, momentarily forgetting the danger that is ever-present. As he stretches hi ...

Dumb Bill Mckibben and Climate Change Essay

Dumb Bill Mckibben and Climate Change Essay Dumb: Bill Mckibben and Climate Change Essay October 8 meeting Book Review for CTL The title of Bill McKibben’s latest book, Eaarth, sounds like the last cry of someone falling off a cliff. McKibben has been writing about Climate Change since he published The End of Nature 20 years ago, always mixing a prophetic pessimism about the magnitude of the danger with an activist’s optimism about how disaster could be avoided. In the two years since the publication of his last book, Deep Economy, the option of avoidance has disappeared. Eaarth is McKibben’s name for the new less friendly and more unpredictable planet humans now inhabit. Two years ago, people were still quaintly worried about the effect of Climate Change on their grandchildren. Today its effects are already upon us. â€Å"Eaarth,† he concludes starkly â€Å"represents the deepest of human failures.† This book is worth reading now because it fully acknowledges three recent catastrophes: the acceleration of geophysical climate changes, the near collapse of the global economic system, and the failure of the U.N. Copenhagen Climate conference to arrive at any meaningful international agreement. McKibben’s prescriptions for what has changed from avoidance to adaptation are consistent with what he and many others have been advocating since 1970: recognizing limits to growth, promoting localism and decentralization, and affirming that conservation and satisfaction of basic needs must replace our inflated excesses of consumerism and greed. During the years he was working on this book McKibben was remarkably successful in organizing two grassroots worldwide movements largely driven by young people, Step-It-Up and 350.org. Despite their failure to effect the kind of changes needed, his recommendations for adaptation to our reduced circumstances could allow us to face them â€Å"lightly, carefully, gracefully.† SBC business 1 Personal Introductions; 2 General Introduction 1 Why do this? 2 Influence classes? Create change? Activist group? Change university?- Two committees to do that, with very limited success 3 Curricular addition or reform seems unlikely with interim leadership 4 Change in College of Ag- Hunter and group†¦but†¦ 5 Books influence on me- mood and action 1 Natural Capitalism- 1995, 2 Earth in Mind 3 Resilience Theory, 4 Michael Pollan; 6 Why read these books; stay oriented; everything changing fast 1 List of books and perspectives- last two years 2 Old news; sustainability is kind of old 3 Cal Poly’s shifts 4 California shifts 7 Debates and reviews and responses: Friedman vs. McKibben 1 agree and disagree; enthusiasms and rhetoric and critique; 2 Changed personal perspectives: 3 Books in retrospectMcdonough and Cradle to Cradle 4 Apocalyptic messages vs. retained normalcy 5 Philosophical and spiritual condition of collapse 6 Resignation vs. hope 7 Tone: frantic vs. composed 8 Exchange viewpoints and learn from other disciplines 3 Scheduling next meeting; later ones at next meeting 1 Sandy teaches Friday 10 am; OK TTH 9-11 or 12-2 2 Kate: move to third Friday 3 Jim Harris teaches Friday morning 4 Christine: Also note I will not be there on Friday, but would be happy to attend on Tuesdays or Wed/Thurs afternoons this quarter. 4 Picking book; Chris’s suggestion; my list Eaarth 1 SM Comments 1 Title of his tenth book- a cry of desperation, falling off cliff 1 â€Å"Eaarth,† he concludes starkly, â€Å"represents the deepest of human failures.† 2 Emotional appeal of chapter 1- how to tell the story, sound the alarm- â€Å"Alarmism†? 3 McKibben as rhetorician: Beauty of the old earth; Apollo image; switch from grandchildren to hometown; present economic costs 2 Biblical Myth- Isaiah, Noah’s Ark, Herbert’s Dune 1 Go and tell this people You may listen and listen but you will not understand

Oldham Pond study Lab Report Example | Topics and Well Written Essays - 1250 words

Oldham Pond study - Lab Report Example Data was collected from Oldham Pond which is a 235-acre natural pond located in an urban area in two towns, Pembroke and Hanson. The sources of water for the pond are a small tributary, wetlands areas and cranberry bogs of Herring Brook and drains into Furnace Pond. The pond has a 2.8-mile shoreline which includes residential houses and summer camp. It has an average depth of 10 feet while the deepest point in the pond is 15 feet. Geographically, the pond is at a latitude of 42.06701 N and 70.83644 W. The data set was collected from the SW shore, N. Haledon at an interval of three weeks; the first data being collected were collected on 4th February 2012 and the second data was collected on 25th February 2012. The study area is shown in figure 1 in the appendices page. Data collection method The data collected was on temperature, dissolved oxygen, conductivity, Ph and the total alkalinity. Moreover, the prevailing weather conditions were noted including the temperature and the wind co nditions. During the first visit, data was taken on at the surface and at a depth of one meter. In addition to the two depths where the parameters were measured from in the first visit, the second study included measurement of the parameters at the bottom of the pond. Equipment with the ability to measure Ph, conductivity, temperature and dissolved oxygen at once was used. As noted by Stephens et al (431) measuring of Ph, temperature and conductivity give the best results when carried out at the sampling point using portable equipment

Personal Statement Essay Example | Topics and Well Written Essays - 500 words - 12

Personal Statement - Essay Example working at a hedge fund as a junior trader in Goldwater Capital Corp, New York where my responsibilities include reconciling cash, positions, coupons, pay-downs, write-downs and wires for various cash accounts; handling daily and end-month accounting, third party administration, and audit work. I also have the responsibilities of closely examining and monitoring stock market on daily basis and I have initiated new trading strategies that have boosted the firm’s quarterly revenue. I have also worked with Klynveld Peat Marwick Goerdeler (KPMG) Accounting/ Advisory where I performed compliance attestation examinations on third-party recipients of the Universal Service Fund disbursements for a large government entity. My duties included obtaining and reviewing documentation and work papers, performing test procedures and documenting results, as well as managing workload and proactively communicating findings to KPMG engagement leadership and clients. Here, I gained immense knowledge on telecommunications accounting. I also performed attestation engagements in accordance with Yellow Book and Generally Accepted Government Auditing Standards (GAGAS) requirements in addition to participating in an agreed-upon procedure engagement for a third-party independent review in evaluating a newly implemented billing system and assisting the management in verifying the accuracy and completeness of invoices generated. My responsibilities included drafting the agreed-upon procedures, providing guidance to new hires, performing test procedures and documenting results, managing workload and proactively communicating findings to KPMG engagement leadership and clients. Here, I gained much knowledge on the nature of agreed-upon procedure engagements. In KPMG, I also participated in performing a payphone compensation attestation of a telecommunications service provider. My duties included performing and documenting audit procedures, obtaining and reviewing documentation, and testing

Common Software Vulnerabilities', Database Security, and Attacks Essay

Common Software Vulnerabilities', Database Security, and Attacks on Networks discussion - Essay Example Linux has applications from cars to cameras and Raspberry Pi and the bug could be fatal in Android, IBM machines, and Windows (Johnson, 2011). The primary source of the attack emanates from the web where a hacker could manipulate the bug to add malicious code on websites or to funnel information such as health records or bank details (Fogel, 2013). Shellshock allows the intruder to access each internet-powered device in an individual’s home from very innocuous entities such as smart light bulbs. Rated at ten on the severity check, the only solution to the vulnerability is updating devices with patches by the website and server owners to secure their clients. While antivirus and firewalls are the initial defenses for most organizations, they will not to be able to stop the attacker getting in this way and, therefore, must be advised to obtain operating system updates from software vendors. The bug is believed to have been in existence for 25 years, to its discovery by Linux’s expert Stà ©phane Chazelas. For instance, Apache web server operates Bash in its background in executing tasks such as processing personal data keyed in through online forms. Encryption in databases has worked its way to the top of the priorities list in the current IT sector. Applications and firewalls no longer suffice in protection of data and businesses in the present day’s complex and open IT environments. Complying with a number of regulations and mitigating the risk are the main drivers forcing database encryption onto the security agenda. However, there are some proposed corrections to the challenge. At the moment, businesses are taken by key management, concerning the largest challenges as database encryption. They are also grappling with matters such as a way to seclude security management and databases, controlled usage, key copying and the means to offer the security auditor proof of secure systems (Cherry, 2011). Governments for are insisting on encryption to

Principles of Construction Management

Principles of Construction Management Contents (Jump to) 1. Gulick’ 7 Functions 2. Fayol 3. Management Theories 4. Challenges Managing People in Construction 5. Conclusion 6. Bibliography Word Count 2070 1. Gulick’ 7 Functions In 1937, social scientists Luther Gulick and Lyndall Urwick (Papers on the Science of Administration) describe seven â€Å"major activities and duties of any higher authority or organisation†. Since then, the acronym POSDCORB has been used to describe the 7 functions of managers: This essentially refers to the various steps or stages involved in a typical administrative process. POSDCORB stands for: Planning: This essentially refers to establishing a broad outline of the work to be completed and the procedures required to implement them. Organising: Organising involves establishing a structure of authority, formally classifying, defining and synchronising the various sub-processes or subdivisions of the work to be done. Staffing: This involves recruiting and selecting the right candidates for the job and facilitating their orientation and training whilst maintaining quality in their work and their environment. Directing: This comprises of continual decision making and delegating structured instructions and orders to execute them. Coordinating: This basically refers to arranging and piecing together the various components of the work. Reporting: Reporting involves regularly updating knowledge about the progress or the work related activities. The information dissemination can be through records or inspection. Budgeting: Budgeting involves all the activities that fall under Auditing, Accounting, and Control. POSDCORB generally fits into the Classical Management movement, being classified as an element of scientific management. Gulick’s POSDCORB principles were instrumental in highlighting the theory of span of control, or limits on the number of people one manager could supervise, as well as unity of command to the fields of management and public administration. For Luther Gulick, the central problem of administration was determining how to achieve the coordination and control necessary to accomplish organisational objectives. His solution was to establish a strong chief executive to counter the divisive aspects of increasing specialisation and division of labour. 2. Fayol Gulick and Urwick built their ideas on the earlier 14 Principles of Management by Henri Fayol in his book General and Industrial Management (1918). Fayol defined theory as â€Å"a collection of principles, rules, methods, and procedures tried and checked by general experience† (Fayol 1918) Fayols 14 Principles Division of Work Authority and Responsibility Discipline Unity of Command Unity of Direction Subordination of Individual Interest to General Interest Remuneration of Personnel Centralisation Scalar Chain (line of authority with peer level communication) Order Equity Stability of Tenure of Personnel Initiative Esprit de Corps Fayol’s influence on Gulick is evident in the 5 elements of management discussed in his book. Fayol clearly believed personal effort and team dynamics were part of an â€Å"ideal† organisation. Planning – examining the future and drawing up plan which areas of action Organising – building up the structure (labour and material) of the undertaking Command- maintaining activity among the personnel Co-ordination – unifying and harmonising activities and efforts. Control – seeing everything that occurs conforms with policies and practices. Fayol’s five principle roles (Plan, Organise, Command, Co-ordinate, and Control) of management are still actively practiced today. The idea of giving authority with responsibility is also widely commented on and is well practiced, though his principles of â€Å"unity of command† and â€Å"unity of direction† are not adhered to in the structure of choice in many of today’s companies. 3.0 Management Theories There are several important management theories which basically classified are as follows: The Scientific Management School such as the works of Frederick W. Taylor and Lillian Gilbreth’s motion study, The Classical Organisational Theory School such as the works of Henri Fayol’s views on administration, and Max Weber’s idealised bureaucracy, The Behavioural School with the work of Elton Mayo and his associates. Management is the process of designing and maintaining an environment in which individuals, working together in groups, efficiently accomplish selected aims (Koontz and Weihrich 1990, p. 4). Theories provide an understanding of what we encounter. A theory provides criteria for what is relevant. Theories enable us to communicate effectively and develop more and more complex relationships with other people. Theories make it possible to keep learning about our professions with continuous development. Management Theories Since the late 1800’s management theories and scientific approaches have been produced by a number of people such as Henri Fayol, Fredrick Taylor, Elton Mayo, Henry Gantt and Frank and Lillian Gilbreth. These people introduced the classical and scientific approaches and over the years developed these principles through their working careers. These styles have changed, merged and stayed the same depending of the person implementing their ideas and the type of company they work for. The traditional classical approach started around the beginning of the 19th century and mainly focused on efficiency together with bureaucratic, scientific and administrative styles of management. The bureaucratic style of management tends to rely heavily on a structure of guidelines such as rules and procedures. While the scientific approach to management mainly focuses on â€Å"the best way to do a job† and the administrative style really emphasises the flow of information in the operation of the organisation. Later towards the end of the 20th century the empowerment style was developed and as a result helped give the employee a sense of responsibility. This was done by offloading some of managements work onto the shop floor and turn gave the employee a sense achievement and direction at work. Modern Theories of Management, Human Relations Douglas McGregor (1906-1964): Who is best known for his formulation of two sets of assumptions- Theory X and Theory Y. McGregor argued that managers should shift their traditional views of man and work (which he termed Theory X) to a new humane views of man and work (which he termed Theory Y). According to McGregor, A theory X attitudes man was lazy and work was bad were both pessimistic and counterproductive. Theory X assumes that people have little ambition, dislike work, want to avoid responsibility, and need to be closely supervised to work effectively. Theory Y, proposed that man wanted to work and work was good. Theory Y offers a positive view, assuming that people can exercise self-discipline, accept responsibility and consider work to be as natural as rest and play. McGregor believed that Theory Y encompassed the true nature of workers and should guide management practice.   Ã‚   Fig 1. Douglas McGregor Theory X and Y. Scientific management – This type of management was introduced by Frederick Taylor and focuses on the worker and machine relationship and as a result of this approach helps increase productivity by increasing the efficiency of the production processes and as a result of his research, Ford Motor Co. embraced this style of management. This type is also designed so that each member of staff has a specified, well controlled task that can be performed as instructed. Time and motion – Frank and Lillian Gilbreth developed this method by focusing on identifying the individual motions of a task. These motions were combined to form both the methods of each operation and the time it took to carry out each task. They believed it was possible to design and time the method of each task in advance, rather than relying upon observation of trial and error. Administrative Management – Henry Gantt developed the Gantt chart, which is used for scheduling overlapping tasks over a period of time. Gantt charts have since become a common technique for representing the phases and activities of a working project and break down the structure so they can be understood by all. Gantt’s management approach focused on motivational schemes and as such emphasised heavily on rewarding staff for good work as opposed to disciplining them over poor work. He also looked at the quality of management skills in building effective industrial organisations. Motivation – Abraham Maslow developed the human relations and behaviour theory in the 1950/60s by distinguishing between what motivates people to do certain activities. His theory suggested that people had to satisfy one level of need before moving onto the next and this in turn resulted in what ultimately motivates people / staff. This is shown in the pyramid illustration as shown below. Fig 2 . Maslow’s Hierarchy of Needs Empowerment – This style of management is a modern theory and was developed in the early 90’s and basically gives the employee a sense of power at work. This is carried out by the employee being authorised by their superior to carry out certain duties without the need to seek approval from above. This type gives the employee a sense of responsibility and achievement while helping to reduce the workload of their boss and in turn cuts down the amount of work the manager has to do as they have delegated certain responsibilities. 4. Challenges Managing People in Construction As highlighted in numerous government and academic reports (Latham, 1994; Egan, 1998, Fairclough, 2002), the construction industry is a sector of the economy which faces many challenges, especially in terms of performance. There are many challenges facing a construction manager. Many challenges are a result of construction operations, while others are a result of indirect activities. A number of challenges are not construction related issues but must be addressed and managed by the construction manager. These issues include workforce/labour considerations, safety, time, and the changing nature of construction work. The construction industry in general is a labour intensive industry and the role of construction manager is to manage people in a strategic and tactical way. One way of managing people would be a classical theory on human behaviour / relations such as Elton Mayo’s on motivation, as a group working dynamics will always have an impact on the projects performance. The term group working dynamics refers to the attitudes, energy and interaction of its group’s members and leaders. The groups working dynamics will always be dependent on the overall effectiveness and efficiency of the project depending on the coordinated efforts of staff working together as a team. Human resource is the most valuable asset in construction industry. Human resource practices are generally concerned with gaining value through increased skills, productivity, contribution, and cost consciousness and productivity are the important factors affecting the overall success of any construction project. Human resource management is the process of finding out what people want from their work, what an organization wants from its employees, and then matching these two sets of needs. Construction projects depend on the knowledge and skills of planning and executing the work. The quality of this most important resource: people, which is what differentiates one team or company from another. Having talented management on board to guide and direct a project is paramount. Having the right balance of skilled and unskilled workers to perform the work is a basic necessity. Finding and recruiting sufficient numbers of skilled, talented people is becoming increasing difficult. There are many reasons this is a problem. One of which is construction is generally viewed as being one of the least desirable industries in which to work. By nature construction is dangerous, dirty, hard work. Other industries out there offer preferred work environments that are cleaner, safer, and generally more desirable. Consequently, there is a severe shortage of talented people willing to work in construction. In order to maximise long term performance, it is important to provide the training necessary to enlighten your workforce. Leadership must be developed among the workforce to aid in effectively coordinating work activities by providing communication links between management and labour. This provides the opportunity for upward mobility and gives motivated people the chance to advance professionally. Empowerment leads to high levels of commitment, enthusiasm, self-motivation, productivity, and innovation. Benefits of this include feelings of appreciation, belonging, and heightened self-worth. Empowerment enables employees to make decisions for which they are accountable and responsible. Empowerment of workforce is one of the keys to improving construction performance. 5. Conclusion – The management theories that have been discussed, important as they are, have to be translated in practice by construction managers, For practicality, all construction managers must develop three sets of skills, namely; conceptual, technical, and human ( Fleet and Perterson 1994, p. 25). A good construction manager should also be able to see members of the organisation as human beings who have needs and psychological feelings and emotions. The development of management theory involves the development of concepts, principles, and techniques. There are many theories about management, and each one ad to our knowledge of what managers should do. Each one has its own characteristics and advantages as well as limitations. The operational, or management process combines each and systematically integrates them. The styles of management best suited to construction are a blend of all described above whilst trying to motivate staff using both the autocratic and democratic approaches because of the need to be one type of boss with one employee and another with somebody else. This is extremely prevalent when dealing with health and safety where and autocratic authoritative style is a prerequisite to the success of reducing the risk of accidents on site. Therefore a manager who makes definitive attempts to translate theory into practice is more likely to increase productivity than a manager who chooses to use the trial and error method of management. 6. Bibliography Egan, J (1998) Rethinking construction: report of the construction task force on the scope for improving the quality and efficiency of UK construction, DETR, London. Fairclough, J., (2002), Rethinking construction innovation and research: A review of government RD policies and practices, Department of Trade and Industry, London Fayol, H. (1949). General and Industrial Management. (C. Storrs, Trans.). London: Sir Isaac Pitman Sons, LTD. (Original work published 1918) Fryer, B. (2004) The Practice of Construction Management, 4th Ed, Oxford: Blackwell Publishing Ltd. Gulick, L. H. (1936). Notes on the Theory of Organization. L. Gulick L. Urwick (Eds.), Papers on the Science of Administration. Koontz Harold and Weihrich Heinz (1990) Essentials of Management, Fifth Edition, McGraw-Hill. Latham, M., (1994), Constructing the team, HMSO, London Oxley, R. And Poskitt, J. (2007) Management Techniques Applied to the Construction Industry, 5th Ed, Oxford: Blackwell Publishing Ltd. Winch, G.M. (2008). Managing Construction Projects, Oxford: Blackwell Publishing Ltd. Websites Figure 1 taken from Beta Codex Network (2008) The Way People Are [Online] available from http://www.betacodex.org/de/node/508 [Accessed February 2014] Figure 2 taken from Maslows hierarchy of needs [Online] available from [http://en.wikipedia.org/wiki/Maslows_hierarchy_of_needs [Accessed February 2014] S150-943

Natural Descriptions in Coleridges and Lord Byrons Texts Essay

Natural Descriptions in Coleridge's and Lord Byron's Texts Works Cited Missing Two closely related texts, one that we've studied in this class and one that we haven't, that handle natural description differently are Coleridge's "The Rime of the Ancient Mariner" and Lord Byron's "Manfred." Both of these texts' central characters have experienced trauma, and their portrayal of their environments reveal the effects that the events have left on them. While Coleridge's mariner is unable to consolidate his past and is relegated to constantly relive it, Byron's Manfred has protected himself from his unnamed vice by distancing himself from his feelings and environment. Obvious parallels exist between the poems, but what I found most striking was the way the narrator illustrates the events and how they result from their mode of handling the traumatic events. The Mariner comes to terms with killing the albatross, and consequently killing his crewmates, by repeatedly voicing his guilt. His description of the souls passing him "like the whiz of [his] crossbow," (l 224) assumption that telling his tale to the hermit will "wash away/ The albatross' blood," (ll 512-13) and expression that "The pang, the curse, with which they died/ Had never passed away" (ll 438-39) shows how the mariner can never accept his actions and alleviate his guilt. I think that it's natural for people to want to come to terms with their past actions in order to better accept one's present state of self, which is why the mariner continually attempts to reconcile his past. The mariner is unable to accomplish this by telling others his story. His descriptions of the story's retelling are affected by his lack of reconciliation. He projects himself into the land... ...o the heavens, and the earth to Mont Blanc which is described as the "monarch of mountains" (1.1 60). The spirits are influential in the stories prominently for the two characters, which reflect the preoccupations and processes of dealing with their traumas. Lastly, the realization that the environment is subjective, due to the power that the mind holds. As Manfred acknowledges, "The mind which is immortal makes itself / Requital for its good or evil thoughts" (3.4 129-130). This originally appears in Milton's Paradise Lost, implying that it's the mind that creates the heaven or the hell. And although Manfred's view on the mind is dark, and very sceptical, he does realize the creative power available to the subject. This same power is expressed in in their descriptions of nature and is influenced by the methods that they go through in dealing with their trauma.

Cheating In Relationships Essay

Many people today have sought the cruel and unfair reasons for relationship problems and cheating. Philosophers of the past have analyzed various contributing factors such as flirting with others, not happy with one another anymore, too much time spent with the opposite sex, other is not sexually active with the other anymore, or one just doesn’t want to be in the relationship any longer but simply knows of no other way to get out. All of these are the causes of cheating in relationships. There is a quote that states â€Å"A relationship is not a test so why cheat?† This quotes says a lot. There are so many causes to cheating in relationships but why do it? Why should you let someone or something get in the way of your love life and your feelings for your loved one? If you truly love someone, other things or people won’t matter to you or catch your eye and make you develop feelings for them and lose your feelings for your partner. You should always think about the effects of cheating on your partner/spouse. The effects of cheating in a relationship can be very severe or could not mean anything at all to someone. Some effects of cheating cold result in suicide, violence, depression or maybe even death. To me, those effects are extremely severe and could be life-changing. I have heard many stories about a partner or spouse cheating on one another and it resulting in death of one or the other. Cheating is very harmful to people and should not be done in any way at all possible, not physically, emotionally or sexually. In the bible, cheating is defined as Adultery and it is illegal which I fully believe it should be illegal to this day. Now that you know the causes and the effects that cheating in relationships has on your partner, maybe you will think twice about doing it. Hopefully you won’t think about doing it all though. Just remember that there is a strong possibility that you could be putting someone’s life in danger because of the effect of cheating. Works Cited Williams, Lila Rankin. â€Å"â€Å"He cheated on me, I cheated on him back†: Mexican American and White adolescents’ perceptions of cheating in romantic relationships.† Phoenix, Arizona. Elsevier Ltd. 2011. Hickle, Kristine E. â€Å"â€Å"He cheated on me, I cheated on him back†: Mexican American and White adolescents’ perceptions of cheating in romantic relationships.† Phoenix, Arizona. Elsevier Ltd. 2011.

Chikungunya virus Essays

Chikungunya virus Essays Chikungunya virus Essay Chikungunya virus Essay Abstraction The revival of Chikungunya virus ( CHIKV ) in several parts of Thailand runing from southern, northeast and North of Thailand with reported instances about 30,000 instances, get downing in October 2008 and ongoing until now ( November 2009 ) , has pointed out the public wellness concern. The chief clinical characteristics are onset of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia. The four about complete genome, representatives of 2008 and 2009, have been determined. Our survey shows that the closest related to the isolate in this eruption were the isolates from Kerela, South India of 2008 ( RGCB80, Accession No. GQ428212 ) demoing two coding part permutations: nsP2-L539S and E2-K252Q and the strain which predominant is ECSA strain, in contrast of the all old eruptions in Thailand which were Asiatic strain. Introduction Chikungunya Virus ( CHIKV ) is an enveloped, positive individual strand RNA virus with a genome of ? 11.8 kilobit [ 1 ] and belonged to the household Togaviridae and genus Alphavirus presently dwelling of 29 accepted members [ 2 ] . There is a 7-methylguanosine capped at the 5 terminal but a polyadenylated at the 3 terminal. The 5 two-thirds of the genomic RNA are responsible for the non-structural proteins. While the 3 tierce of the genomic RNA serves as the messenger RNA for the synthesis of the viral structural proteins [ 3, 4 ] . Harmonizing to the genomic organisation of other alphaviruses, the CHIK genome is acknowledged to be: 5 cap-nsP1-nsP2-nsP3-nsP4- ( junction part ) -C-E3-E2-6K-E1-poly ( A ) 3 . Alphaviruss have conserved sequences at the 5 and 3 terminals every bit good as the intergenic part. Among alphaviruses, conserved repeated sequence elements ( RSEs ) are besides observed in the 3 nontranslated part ( NTR ) . These conserved spheres play an of import func tion in the ordinance of viral RNA synthesis [ 5- 8 ] . CHIKV causes Chikungunya febrility ( CHIKF ) and chief clinical features include sudden oncoming of febrility, icinesss, concern, myodynia, maculopapular roseola and terrible arthralgia, which mostly affect the carpus, articulatio genus, mortise joint and little articulations [ 9 ] . The febrility about invariably precedes the roseola and joint hurting and has infrequently been reported as biphasic with return noted on the 4th or 5th twenty-four hours of unwellness [ 10, 11 ] . No studies of biphasic febrility were described during the 2005–2007 eruptions. In past eruptions, instances of feverish paroxysms in immature kids were besides reported [ 12 ] . Maculopapular and erythematous in character of the non-pruritic roseola is typically found and it will be seeable after infection for 2-5 yearss and may last up to 10 yearss. This roseola is distributed chiefly on the face, limbs and bole of the organic structure. Possibly the most important symptom of CHIKV infection is the te rrible articulation hurting that occurs with virtually every clinical instance [ 13, 14 ] . The patients who often reported disabling hurting that lasts for hebdomads or months have shown the articulations exhibiting enormous tenderness and swelling. Most infections wholly resolve within hebdomads or months but there have been documented instances of CHIKV-induced arthralgia prevailing for several old ages with up to 12 % of patients with CHIKV disease developing chronic articulation jobs [ 15- 17 ] . CHIKV was foremost described from the serum of a fevered homo during an eruption in Tanganyika ( now Tanzania ) in 1952–1953 during an epidemic of dengue-like unwellness [ 10 ] . Serologic and antigenic word picture of the isolates suggested that it was an alphavirus closely associated to Mayaro and SFV, while the initial appraisal was that the eruption was because of a dandy fever virus [ 18, 19 ] . Retrospective instance reappraisals have proposed that CHIKV epidemics occurred every bit early as 1779 but were often described inaccurately as dandy fever outbreaks [ 20 ] . During the sixtiess and 1990s, the virus was determined repeatedly from several states in Central and Southern Africa including Sudan, Uganda, Democratic Republic of Congo ( DRC, officially Zaire ) , the Cardinal African Republic ( CAR ) , Malawi, Zimbabwe, Kenya and South Africa. CHIKV has besides been isolated in western African states including Senegal, Benin, the Republic of Guinea, Cote dIvoire and Nige ria [ 21 ] . The virus is believed to hold originated in Africa and later was introduced into many parts of Asia [ 20 ] . Phylogenetic analysis of the CHIKV genome based on partial E1 sequences has identified 3 line of descents ; West African, Asian and East, Central and South African ( ECSA ) lineages [ 22 ] . In Africa, the virus is maintained through a sylvatic transmittal rhythm between wild Primatess and mosquitoes such as Aedes luteocephalus, Aedes furcifer, or Aedes taylori [ 23 ] while in Asia has been an urban transmittal rhythm, typically found in dengue-endemic countries and transmitted from human to human mostly by Aedes aegypti and, to a lesser extent, by Aedes albopictus [ 24 ] . The first CHIKV isolation in Asia was in Thailand in 1958 [ 25 ] and so other eruptions have been documented including Cambodia, Vietnam, Laos, Myanmar, Malaysia, Philippines, and Indonesia [ 23 ] Beginning in 1986, CHIKV outbreaks resurged with major disease bunchs documented in Senegal in 1986 and 1996/1997 [ 24 ] , Ivory Coast in 1996/1997 [ 26 ] , DRC during 1998–2000 [ 27 ] , Indonesia in 2003 [ 28 ] . Outbreaks occurred about continuously during 2004–2007 with 100s of 1000s of reported instances and new geographical countries involved [ 21 ] such as Kenya in 2004, Comoros in 2005 [ 29 ] , several Indian Ocean islands, in 2005, and India, in 2006-2007, which was an eruption of unprecedented magnitude [ 30 ] . Cases were besides reported in Europe ( UK, Belgium, Germany, Czech Republic, Norway, Italy, Spain and France ) , Hong Kong, Canada, Taiwan, Sri Lanka and the USA ; these were straight associated with the return of tourers from India and affected islands of the Indian Ocean [ 31 ] . The prevailing Aedes species in Madagascar and Reunion islands during 2005–2006 and in India in 2006/2007 was Aedes Albopictus [ 32 ] . The spread of chikungunya into rural countries during the ulterior phases of eruptions in India farther confirmed the potency of Aedes albopictus mosquitoes in conveying CHIKV [ 33 ] . These alterations were coincident with the outgrowth of a strain holding an alanine to valine permutation at codon 226 ( A226V ) of the envelope 1 ( E1 ) cistron in Reunion Island [ 34 ] and India [ 35 ] . This mutant is known to increase the transmissibi lity of the virus by Aedes albopictus [ 36 ] . This incident has been documented with the equid avirulent, Venezuelan equine phrenitis subtype ID viruses, where every bit small as 7 amino acid alterations can make epidemic forms of the virus responsible for immense eruptions [ 37 ] . The late September to October 2008, CHIKF eruptions have arisen in many southern states of Thailand particularly in Narathiwat, the southernmost state. There are plentifulness of Aedes Albopictus, the vector for CHIKV, in the plantation country, the common country of southern Thailand, and CHIKV was isolated from Aedes Albopictus in this outbreak country every bit good [ 38 ] . The suspension of CHIKF may be due to failure to observe low degree, continued transmittal in worlds, peculiarly because the symptoms may be mistaken for dandy fever febrility plus there is no accredited vaccinum or specific drug therapy available to bring around the unwellness, intercession relies upon vector control and minimising mosquito-human contact. Although there are several complete genomes of CHIK available in GenBank, the complete nucleotide sequence of CHIK distributing in Thailand is non available. In this survey, we conducted the about complete nucleotide sequence of virus isolated from four serum in 2008 and 2009, from Narathiwat state, the southernmost of Thailand and Bangkok where forbearance returned back from Nakhonsrithammaraj, the South of Thailand, inside informations were provided in table 1. In add-on, the phyletic beginning and the diverseness of the CHIKV strains responsible for reemergence in Thailand are besides considered. Method RNA extraction and RT-PCR CHIKV have been isolated straight from the patient s sera or from cell civilization which came from Vero cell at the first transition and the inside informations of sample were provided in table 1. Viral RNA were extracted by Viral Nucleic Acid Extraction Kit ( RBC Bioscience, Taiwan ) harmonizing to maker s process followed by contrary written text polymerase concatenation reaction ( RT-PCR ) utilizing Superscript III Pt One-Step Quantitative RT-PCR System ( Invitrogen, Carlsbad, CA, USA ) . A reaction mixture consisted of 2 ?l of extracted RNA, 5 ?l of 2x reaction mixed, 0.1 ?l of superior contrary RNA polymerase III Pt Taq polymerase, 0.5 ?M of each primer, and 6 ?l with nuclease-free H2O. The RT measure and PCR elaboration were performed in a Eppendorf Mastercycler personal ( Eppendorf, Hamburg, Germany ) at one time under the undermentioned conditions: contrary written text at 50 C for 30 min ; later initial denaturation at 95 C for 3 min ; followed by 40 rhythm of denaturation at 95 C for 1 min, primer tempering at 55 C for 1 min, and extension at 72 C for 1.30 min ; and concluding extension at 72 C for 7 min. All primers were used as show in table 2 which was designed towards S27 strains ( GenBank accession no. AF369024 ) [ 35 ] . Then the amplified PCR merchandises were analyzed by cataphoresis with 2 % -agarose gel in TBE buffer and stained by ethedium bromind, the expected set for the merchandise were visualized under UV visible radiation, excised from the gel and purified with the QIAquick Gel Extraction kit ( RBC Bioscience, Taiwan ) following the maker s instructions. The purified PCR merchandises were so used for direct sequencing by First BASE Laboratories SDN BHD ( Selangor Darul Ehsan, Malaysia ) . Table 1 Sample inside informations used in this survey sample codification day of the month of aggregation topographic point GenBank Acc No sample type CU-Chik661 2009 Narathiwat biological sample CU-Ckik009* 2009 Capital of thailand biological sample CU-Ckik10 2008 Narathiwat biological sample CU-Chik683 2009 Narathiwat virus isolate *patient returned from Nakhonsrithammaraj, the state in the South of Thailand. Table 2 Primers used for whole genome sequencing fragment cistron primer ( a ) Sequence ( 5 to 3 ) 1 5NC 18F CACGTAGCCTACCAGTTTCTTA nsP1 871R ATGGAACACCGATGGTAGGTG 2 nsP1 616F AACCCCGTTCATGTACAATGC nsP1 1435R CGGTACCACAAAGCTGTCAAAC 3 nsP1 1317F CACTGACCTGCTGCTGTCTATG nsP2 2130R AGTCCTGCAGCTTCTTCCTTC 4 nsP1 1412F CGAGTTTGACAGCTTTGTGGTA nsP2 2227R ATGACTGCAATTTTGTATGGGC 5 nsP2 1908F CAATCTCGCCTGAAGACTTCC nsP2 2709R TCCACTACAATCGGCTTGTTG 6 nsP2 2530F GTGCGGCTTCTTCAATATGATG nsP2 3343R TCCAGGCCTATTATCCCAGTG 7 nsP2 2577F AACATCTGCACCCAAGTGTACC nsP2 3504R GTCTCCTGTTGGCCGGTATAAT 8 nsP2 3332F TAATAGGCCTGGAGGGAAGATG nsP3 4134R CTACGCACTCTTCATCGTTCTT 9 nsP2 3885F GAACGAGTCATCTGCGTATTGG nsP3 4725R ATATCTCTGCCATATCCACTGC 10 nsP3 4458F TCTTTACAGCCATGGACTCGAC nsP4 5874R TCTACTTTGCGCGACTGATACC 11 nsP4 5630F CCCAGTATTCTTGGTTGCATG nsP4 6380R AAAACAGCACGCTTACCACG 12 nsP4 6184F AAAACAGCACGCTTACCACG nsP4 6936R AACTTGAAGCGCGTACCTGTC 13 nsP4 6732F TCATAGCCGCACACTTTAAGC nsP4 7495R AGGACCGCCGTACAAAGTTAC 14 nSP4 7278F GCAGGTGACGAACAAGATGAG C 8034R CCGCTTAAAGGCCAATTTG 15 C 7910F TCGAAGTCAAGCACGAAGG E2 8670R GTCTGTCGCTTCATTTCTGATG 16 E3 8459F TGCTTGAGGACAACGTCATGAG E2 9240R TTTGTGATTGGTGACCGCG 17 E2 9093F AGTCCGGCAACGTAAAGATCAC 6K 9861R AAAGGTTGCTGCTCGTTCCAC 18 E2 9648F AGTTGTGTCAGTGGCCTCGTTC E1 10403R TAAAGGACGCGGAGCTTAGCTG 19 E1 10145F ACAAAACCGTCATCCCGTCTC E1 11158R TGACTATGTGGTCCTTCGGAGG 20 E1 10959F CAGCAAGAAAGGCAAGTGTGC 3NC 11802R CTCCTACGTCCCTGTGGG The primers for the fragment 1-19 and the forward primer for fragment 20 are used from the published primers [ 36 ] and the contrary primer for fragment 20 was designed in this survey. Assembly of Genome Sequences and Sequence Analysis The genome sequences were analyzed utilizing the BLAST plan available in GenBank ( hypertext transfer protocol: //blast.ncbi.nlm.nih.gov/Blast.cgi ) . Then they were edited and assembled by utilizing CHROMASLITE ( v.2.0 ) and SeqMan ( DNASTAR, Madison, Wis. , USA ) . All sequences were aligned by utilizing Clustal X version 1.83 and phyletic trees were constructed utilizing the neighbor-joining method and Kimura s two-parameter with 1,000 bootstrapping method implemented in MEGA3.1 plan. Consequence Complete genome analysis of CHIKV in Thailand We determined the about full-genome sequences of four CHIKV isolates which were representatives of 2008 and 2009 in Thailand and the inside informations are provided in table1. The lengths of genome sequence of four isolates presented in this paper were 11,811 base brace except isolate CU-ChiK661 was 11,738 base brace. Every isolates shared the same length of big two ORF ; non-structural part 7422 bases ( 2,474 aa ) and structural part 3744 bases ( 1248 aa ) and besides shared 65-nucleotide junction between these two open reading frame excepting stop codon of the non-structural of unfastened reading frame and get down codon of the structural unfastened reading frame. The 5UTR ended at nucleotide place 62 for CU-ChiK661 and 76 for others. The 3UTR part started at nucleotide place 11,299 for CU-ChiK661 and 11,314 for others. Then they were aligned with complete 23 genome sequences available in GenBank. Overall, genome constructions of these four isolates were consistent with old work [ 41 ] . The isolates in this survey were found really closely related demoing 99.79-99.89 % individuality with one another and had an mean whole genome nucleotide individuality of 97.0 % with the S27 paradigm. The isolate which were near related with our isolates was the isolate from Kerala, South India: RGCB80, Accession No.GQ428212 demoing an mean 99.72 % individuality. The most closely related to S27 paradigm CU-Chik661 was the closest one to S27 strain. In the non-structural part showed 34 aa alteration ( 1.37 % ) lined in nsP1 nine aa alteration ( 1.68 % ) , nsP2 6 aa alteration ( 0.75 % ) , nsp3 11 aa alteration ( 2.07 % ) , and nsP4 7 aa alteration ( 1.14 % ) . The nsP3 showed the highest ratio alteration while the nsP2 showed the lowest ratio alteration which correlated with old survey [ 36 ] . When it comes to structural part, ChiK661 exhibited 25 aa alteration ( 2.00 % ) arranged in C 3 aa alteration ( 1.15 % ) , E3 1 aa alteration ( 1.56 % ) , E2 15 aa alteration ( 3.55 % ) , 6K 2 aa alteration ( 3.27 % ) , and E1 4 aa alteration ( 0.91 % ) ( table3 ) . Table 3 Comparison of amino acerb permutations identified in Thailand with that of S27 and other Indian isolates in 2007 and 2008 Region polypeptide place pritein place S27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsp1 29 29 Phosphorus . . . . Second . 105 105 Gram . Roentgen . . . . 128 128 Thymine K K K K K K 172 172 Liter Volt Volt Volt Volt Volt Volt 186 186 Nitrogen . . . . Calciferol . 234 234 Tocopherol K K K K K K 256 256 Tungsten . Roentgen . . . . 376 376 Thymine Meter Meter Meter Meter Meter Meter 383 383 Meter Liter Liter Liter Liter Liter Liter 384 384 I Liter Liter Liter Liter Liter Liter 481 481 Thymine I I I I I I 488 488 Q Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 507 507 Liter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 531 531 Calciferol Gram . . . . . nsp2 583 48 Volt A . . . . . 589 54 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 614 79 Phosphorus . . . . Second . 716 181 Volt A . . . . . 864 329 K Tocopherol . . . . . 909 374 Hydrogen Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1074 539 Liter Second Second Second Second Second Second 1117 582 C Yttrium Yttrium Yttrium Yttrium Yttrium Yttrium 1118 583 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1328 793 A Volt Volt Volt Volt Volt Volt nsP3 1428 95 K Q . . . . . 1508 175 Volt I I I I I I 1534 201 Second . Gram . . . . 1550 217 Yttrium Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen Hydrogen 1659 326 Phosphorus Second Second Second Second Second Second 1664 331 Volt A A A A A A 1670 337 Thymine I I I I I I 1671 338 Thymine . . . . Meter . 1685 352 K Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1709 376 I Thymine Thymine Thymine Thymine Thymine Thymine 1715 382 A Thymine Thymine Thymine Thymine Thymine Thymine 1794 461 Liter Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus Phosphorus 1795 462 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 1804 471 Phosphorus Second Second Second Second Second Second nsP4 1938 75 Thymine A A A A A A 1945 82 Roentgen . . . . Roentgen . 1950 87 Yttrium . . Hydrogen . . . 2117 254 Thymine A A A A A A 2157 294 Volt A . . . . . 2363 500 Q Liter Liter Liter Liter Liter Liter Region polypeptide place pritein place s27 RGCB80/KL07 RGCB356/KL08 ChiK 661 Chik 9 Chik 10 Chik 683 nsP4 2377 514 I Thymine Thymine Thymine Thymine Thymine Thymine 2418 555 Volt I I I I I I 2458 595 Nitrogen . . . . K . 2463 600 Roentgen . . . . I . 2467 604 Volt I I I I I I 2468 605 Thymine . . . . Second . 2469 606 Liter . . . . Meter . mirid bug 23 23 Phosphorus Second Second Second Second Second Second 27 27 Volt I . I I I I 28 28 Roentgen . Thymine . . . . 63 63 K Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen E3 284 24 I Thymine Thymine Thymine Thymine Thymine Thymine 290 30 K . . . Roentgen . . E2 382 57 Gram K K K K K K 399 74 I Meter Meter Meter Meter Meter Meter 404 79 Gram Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 409 84 F . . . Liter . . 485 160 Nitrogen Thymine Thymine Thymine Thymine Thymine Thymine 489 164 A Thymine Thymine Thymine Thymine Thymine Thymine 506 181 Liter Meter Meter Meter Meter Meter Meter 519 194 Second Gram Gram Gram Gram Gram Gram 536 211 I Thymine Thymine Thymine Thymine Thymine Thymine 554 229 Volt . I . . . . 576 251 Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 577 252 K Q . Q Q Q Q 592 267 Meter Roentgen Roentgen Roentgen Roentgen Roentgen Roentgen 624 299 Second Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen Nitrogen 632 307 Q . . . Roentgen . . 637 312 Thymine Meter Meter Meter Meter Meter Meter 669 344 A Thymine Thymine Thymine Thymine Thymine Thymine 675 350 Gram . Second . . . . 700 375 Second Thymine Thymine Thymine Thymine Thymine Thymine 711 386 Volt A A A A A A 6K 756 8 Volt I I I I I I 802 54 I Volt Volt Volt Volt Volt Volt 813 65 Volt . A . . . . E1 1035 226 A Volt Volt Volt Volt Volt Volt 1078 269 Meter Volt Volt Volt Volt Volt Volt 1093 284 Calciferol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol Tocopherol 1113 304 Phosphorus . Liter . . . . 1131 322 Volt A A A A A A 1242 433 C Roentgen . . . . . Non-structural part Compared to S27 and, the CU-Chik661, CU-Chik009, CU-Chik10 and CU-Chik683 isolates have shared 26 permutations in the non-structural part: nine in nsP1 ( T128K, L172V, E234K, T376M, M383L, I384L, T481I, Q488R, and L507R ) , five in nsP2 ( S54N, H374Y, C582Y, S582N, and A793V ) , eleven in nsP3 ( V175I, Y217H, P326S, V331A, T337I, K352E, I376T, A382T, L461P, S462N, and P471S ) and six in nsP4 ( T75A, T254A, Q500L, I514T, V555I, and V604I ) as shown in table3. Most of these alterations were besides found in other isolates from Indian Ocean and Reunion isolate in 2006 and 2007, isolates from Kerala, South India in 2006-2008 and other parts of the universe. Interestingly, there was opal stop codon ( UGA ) at nsP3 codon 524 in the present isolates while S27 and Ross were non. This opal halt codon was besides observed in related alphavirus and old reported CHIKV isolates every bit good [ 35 ] . It is believed to modulate the look of nsP4, the putative RNA polymerase, by read-through mechanism [ 2, 39 ] Additional particular alterations were besides observed in ChiK10 ( nsP1-P29S, nsP1-N186D, nsP2-P79S, nsP3-T338M, nsP4-N595K, nsP4-R600I, nsP4-T605S, and nsP4-L606M ) and ChiK661 ( nsP4-Y87H ) . There was besides alone nucleotide permutation to the CU isolate which was non-synonymous alteration A6811G lined in nsP4 part. Structural part When analysing the amino acerb alteration of the structural protein 24 place were found to be common for the four isolates: three in C ( P23S, V27I and K63R ) , one in E3 ( I24T ) , 15 in E2 ( G57K, I74M, G79E, N160T, A164T, L181M, S194G, I211T, K252Q, M267R, S299M, T312M, A344T, S375T, and V386A ) , two in 6K ( V8I and I54V ) and four in E1 ( A226V, M269V, D284E, and V322A ) The lone one isolate which had specific alteration was ChiK009 demoing three specific aa place alterations ( E3-K30R, E2-F84L and E2-Q307R ) At the nucleotide place 9138, there was a alone event to the CU isolate demoing the same base as S27 and Ross strain while the remainder of other sequences antecedently reported had changed from T to C. 5 and 3 NTRs The 5 NTR of all four isolates were found to portion similarity with one another uncovering the mutant at place 68 from G to T in comparing to S27 which were besides detected in all the recent isolates. Merely did CU-Chik10 hold a mutant at nucleotide place T64A. There was no interpolation or omission has been observed. Within the 3UTR, sequences in this survey revealed the omission of a stretch 14 bases of 19 bases at place 11,369-11,342 compared to S27 except CU-Chik661 showed merely one A omission. This 14-A losing events besides showed in 2006 Indian Ocean isolates [ 35 ] . Phylogenetic analyses Fig.A1 illustrated the phyletic tree base on full genome analysis. CU isolates ( CU-Chik009, CU-Chik10, CU-Chik683 and CU-Chik661 ) arranged closest to isolates from Kerala, South India. Furthermore, they were crusted together with isolates during 2006 reunion eruption and 2007-2008 Indian eruption and related isolates. We besides determine extra E1 partial genome to analyse phyletic beginning as it is of import in phyletic analysis and there is more available sequence of this part including Asiatic and West-African strain. The phyletic tree based on E1 partial genome displayed in fig.A2. It revealed that all isolates in this survey were grouped in ECSA phylogroup. This determination was non the same phylogroup doing the eruption in 1958 in Thailand which was assigned in Asiatic strain. Discussion The first CHIKV described in Thailand was in 1958 in Bangkok [ 25 ] which was subsequently confirmed to be an Asiatic strain. [ 22 ] After that there were still a cyclicity of outgrowth of CHIKV in Thailand demoing a spread of 2-18 old ages: Prachinburi ( 1976 ) , Surinn ( 1988 ) , Khon Khen ( 1991 ) , Loei and Prayao ( 1993 ) , and Nongkhai and Nakorn Sri Thammaraj ( 1995 ) . During those outgrowths, the CHIKV all happened to be Asiatic strain [ 22 ] . CHIKV is presently doing one of the big eruptions reported in the past 50 old ages as in October 2008, bunch of febrility, roseola and terrible arthralgia was detected in one small town at Laharn wellness centre in Narathiwat and so chikungunya was suspected and confirmed subsequently. CHIKV has been distributing to next state of Narathiwat and the close state including Songkhla, Pattani and Yala by detecting several thousand instances reported in each country. Not merely has CHIKV been administering in the nearby country of Narathiwa t but besides go arounding in the other parts of Thailand including sou-east, cardinal, north and E of Thailand demoing more than 30,000 septic instances. The chief factor of distributing across the country is believed to be importing by travellers. This magnitude of the epidemics has arisen concernment of the public wellness of Thailand. As CHIKF was non a notifiable disease in Thailand, therefore the Bureau of Epidemiology had included CHIKF is the latest notifiable disease and launched in November 2008 ( inactive surveillance countrywide ; all gov. infirmaries and some private ) [ 40 ] . This survey revealed the high degree of preservation of this RNA virus within a peculiar eruption that has been of considerable involvement during the patterned advance of 2008-2009 Thailand epidemics. As observed in old findings of samples collected during an on-its-own eruption, isolate sequences showed merely rare alterations stand foring expected degrees of familial impetus connected with an RNA genome. However, some given mutants were identified that may hold an association with samples collected from patients stand foring more terrible unwellness. Our survey represents the first analysis, to our cognition, of intra-outbreak of CHIKV in Thailand of the molecular degree. Our phyletic analyses placed on partial glycoprotein E1 sequences confirmed that CHIKV distributing in Thailand was caused by the same strain on Reunion, Seychelles, Mayotte, Madagascar, Mauritius, Indian Ocean, and India, and showed that this strain is related to East- , Central- and South-Africa isolates non th e Asiatic strain as old eruption in Thailand. In add-on, E1-226 was the lone genotype observed during this eruption. Previous surveies showed that the mutant of amino residue 226 of E1 genome of SFV was observed to let go of the cholesterin dependance of the virus [ 41, 42 ] which might convey an advantage to virus in mosquitoes which are cholesterin auxotrophs, therefore CHIKV might hold the favour from this mutational alteration every bit good. From all sequence of CHIKV except S27 and Ross strains have shown opal halt codon ( UGA ) at nsP3 codon 524. Restricting the figure of transitions is the key because the infecting viral population may maintain up a correspondence to a quasispecies [ 43, 44, 45 ] . Repeated in vitro transitions could move as a filter on this population. For case, the presence in S27 of an Arg codon alternatively of the opal halt codon in other isolates is possibly explained by legion in vitro transitions of S27, as development of opal to Arg was observed by experimentation in ONN viruses [ 46 ] There is no aminic acid alteration detected among this eruption that is unambiguously associated with the Central/East African genotype from which the strain doing the 2008-2009 epidemics evolved. However, there are two alterations, one at the nsP2-L539S and one in the E2-K252Q that about alone to these isolates irrespective of three isolates from Kerala, South India, either alteration alters the hydrophobicity and charge of the amino acid incorporated but the biological relevancy of these alterations can merely be speculated. Chik10 had revealed the most alterations compared to three isolates and Chik10 was the lone sample collected in 2008 and it had specific alterations that have nt shown in other isolates. Therefore those alterations might non remain circulate in this eruption or it was non the strain which predominate. Although CHIKV eruption has happened in Thailand since 2008, it is still ongoing circulate in several parts of Thailand so the farther probe should be considered.

What do you know about computers essays

What do you know about computers essays Prior to attending this class I thought I knew a lot about computers. What Ive learned is that all I really knew was "buzz" words: megahertz, gigabyte, ram, megabyte, etc. I also assumed bigger was better, and there "may" be some truth to that statement. However, it is equally true that bigger is not always necessary. I needed to purchase a computer that would satisfy all the needs and wants of the family. I needed a system that could run accounting software, my wife needed the ability to run graphic programs and the children needed educational software. In addition to having a system with sufficient power to handle these tasks, I wanted the ability to expand the system at a later date, if necessary. Finally, I needed a sufficient warranty. After listening to the advice of friends and sales people, I was no better off than when I started. So I decided to go out on faith and buy what I thought was the best deal for my money. I researched Compaq, Dell, Gateway and some no frills machines. The no frills systems were immediately ruled out; the price was right, the warranty was not. In some instances the warranty was ok, but I was not sure if I would ever see the person who built the system again. I purchased a Gateway select 600 for $2273.00. The system had: 600 MHz Athlon chip, 128 MB ram, 20.0 GB hard drive, CD-RW, DVD, ZIP, 16 MB video, 17" Color monitor(15.9 viewable), HP scanner and Epson 740 stylus color printer(ink jet). All things considering I dont think I did bad, but I now realize that all that hardware was not necessary. I could have forgone the ZIP drive, my main purpose for it purchase was storage, which I now realize that the CD-RW could have done the same job. Not to mention that the CD-RW can hold up to 650 MB, as opposed to the 100 MB on the ZIP. I could have also forgone the DVD, the CD-RW is sufficient. I figured that maybe one day I would watch movies on the system. Not purchas...

Homeless Symposium Essay Example | Topics and Well Written Essays - 750 words

Homeless Symposium - Essay Example Poor people are not able to pay for housing, and the situation is caused by the increased lack of employment opportunities and a decline in public assistance. Inadequate housing facilities have led to homelessness, as the available housing is too expensive thereby becoming unaffordable to the low- income households. Most women have run away from domestic violence together with their children leading them to homeless housing. Many families have ended in homelessness because of lack of affordable health care. The elderly poor individuals have landed in homeless apartments as their health decline and lack of public assistance increases. Drug abuse especially among the youths has made it possible for them to run away to homelessness as the society acts against their behavior. Homelessness in Indiana has adversely affected families and children in substantial levels. The trends depicted in national levels are trickling down to the local levels. Indiana has been ranked 24th in the number of homeless children in the entire nation. Moreover, Indiana has the high rates on the child homelessness making it 29th in the national ranking according to the National Homeless data. According to the national homeless data, in Evansville and its surrounding areas, more than 400 people are homeless of who one third of them are children. In these locales, at least 120 families are homeless daily. During the census of 2000, Evansville and its environs recorded the highest percent of homeless individuals per capita as compared to the numbers in the Indian county. Access to care that provides financial assistance to the target group would prevent them from eviction and will bolster public assistance thus enabling people to live with others. Access to care will enable a person to afford a rent of $ 457 per month if his or her wage earnings are at 30% Area Meridian Income (AMI). In Evansville and its

From the period of the Spanish American War through the end of World Essay - 1

From the period of the Spanish American War through the end of World War two, why does the United States move from relative isol - Essay Example Isolationism denotes to United States’ longstanding unwillingness to become engaged in European wars and alliance. Isolationists embraced the opinion that United States’ perspective upon the globe was dissimilar from that of the European cultures, and that United States could enhance the root of democracy and freedom by channels other than conflict. United States’ isolationism did not denote is entanglement from the global phase. Isolationists, thereby, were not opposed to the impression that the American should be a global player, and much further its ideological, economic, and territorial interests, predominantly within the West Hemisphere. In the 1920's, the United States is seen marinating its isolation policy all through, but also, its aspects of developing into an internationalist. United States can be equated to a jellyfish where it avoided any external involvement except for trade undertakings, and then later it advanced into a hawk- devotedly pledging fo rces to outdoor wars to gain influence and resources. America remained isolationists via factors like dismissal of the Alliance of Nations, as well as closing accesses on migration, yet occasioned internationalist actions. United States moved from a relative isolation to an internationalist when United States domestic support for Cuba independence entangled the American in a conflict with Spain upon the Cuban’s island. The United States went into war with no strategies other than sinking the Spanish convoy in Manila Anchorage and it undertook months to dispatch troops to Spain with the Spanish putting up hardly any resistance. The US was able to conquer Spain; both countries signed the Paris Treaty. The verdict to assist Cuban opposition was a key retreat from the customary United States’ way of liberal patriotism. The consequences of United States’ global involvement resulted in the Cuban sovereignty under the Paris treaty of 1898. The treaty led to the surrender of Spanish chattels to the American country. These included the Guam Island, Puerto Rico and the Philippines. The American abruptly became a colonial hegemony with international dependencies. The United States colonial ac countability became a permanent undertaking and not just a temporary thing. This is seen when United States made reflective changes within its diplomatic posture. This transformation made the United States immune to the early 19th era foreign policies as the nation had transformed and it also possessed nearly all features of a prodigious power. It stood out from other nations in respect to geographic size, population, two oceans, military capability and economic resources. The negotiation of the Paris treaty and the Cuban war placed new responsibilities and duties in the palms of the United States that it vowed to execute as a ruler of nation-states. United States new way of life was a high decree and promise of civilization. The American global involvement rendered it to engage in close as well as more intricate affiliations with other global great powers. This undertaking rendered the conventional foreign policy old-fashioned. This global involvement of the United States saw it re treat from its customary isolation attitude.[4] The American policy formulators were enforced to cogitate a huger global involvement since they had to formulate new policies Asia. This began with the Monroe Policy amendment. The U.S. President Theodore Roosevelt through the Roosevelt Corollary amended the Monroe doctrine. This change was triggered by the uncertainties that the European creditor countries would utilize the unpaid dues of the Latin American countries to obtain political hegemony over them. ________________________________________________________________________ [4]Rosenberg, Emily S. Spreading the American Dream (New York: Hill and Wang, 1982), 27. The Monroe doctrine amendment gave the United States the right to exercise a universal police power in the emergence of a transgression or impotence act by any nation. The